newmicros.net

Home > Parse Error > [w::sam_read1] Parse Error At Line [main_samview] Truncated File.

[w::sam_read1] Parse Error At Line [main_samview] Truncated File.

Contents

With AppDynamics, you get 100% visibility into your Java,.NET, & PHP application. Content Search Users Tags Badges Help About FAQ Access RSS Stats API Use of this site constitutes acceptance of our User Agreement and Privacy Policy. Most IT organizations don't have a clear picture of how application performance affects their revenue. Any ideas how to rectify this? his comment is here

Find More Posts by maubp 10-21-2011, 12:57 AM #5 manore Member Location: paris Join Date: Jun 2011 Posts: 19 Hi maubp, Thanks so much. 2171068307 correspond to the last Any unauthorized copying, disclosure or distribution of the material in this e-mail is strictly forbidden and possibly a violation of federal or state law and regulations. You seem to have CSS turned off. It can also be caused if your computer is recovered from a virus or adware/spyware attack or by an improper shutdown of the computer.

[w::sam_read1] Parse Error At Line [main_samview] Truncated File.

I don't k... Empty SomaticSniper Output Files Hi all, I have a pipeline which I have written in python to do SNP calling and annotation.  The ... Parse error at line 85: missing colon in auxiliary data Aborted (core dumped) Here is that line (85): HWI-ST1097:95:D0U82ACXX:7:1101:1400:2239 16 X 38482098 60 101M * 0 0 CTCTGCAAAATGATATGCAAGTATTAGTTGTGTGTATATTTCTGTTTGTTTGGGATAGCCTTGCCTACTGAAGAGCATAAGAAGCTGGGTTTCTCCTCATT ######################################@=39ABC;>B;D8?0?09*?109D:11*11::1*:22+AC?C<3+3?A:+CD?>BD>DAD

  1. burt Bioinformatics 11 11-25-2012 04:53 PM Thread Tools 10-20-2011, 02:57 AM #1 manore Member Location: paris Join Date: Jun 2011 Posts: 19 error with sam output ->Parse error
  2. Probably they start with 1 rather than zero; maybethey include the header block, maybe not.
  3. W3110)?
  4. Parse error at line 95: missing colon in auxiliary data Aborted head -96 file.sam | tail -5 @SQ SN:chrUn_gl000226 LN:15008 @SQ SN:chr18_gl000207_random LN:4262 @RG ID: LB: SM: PL:ILLUMINA D3B4KKQ1:406:H0YE0ADXX:2:1101:1198:2135 89 chr8
  5. Unless there is another step in your pipeline setting it, the read group tag is set via bwa's -r option (or -R for bwa mem) and it's not obvious how you've
  6. ADD REPLY • link written 4.7 years ago by Dawnoflife • 10 Please log in to add an answer.

How to extract unique mapped results from Bowtie2 bam results? See below for information. Bwa Option That Stops After N Minutes I would like to know if it's possible, or if not, to propose it, the option of running bwa alignm... samtools bwa output • 4.3k views ADD COMMENT • link • Not following Follow via messages Follow via email Do not follow modified 3 months ago by Biostar ♦♦ 10 •

The time now is 03:01 PM. Bam file doesn't show on IGV and pileup VCF has only header I have PE RNA-seq fastq files that I trimmed, aligned, and deduped, split N_CIGAR, recalibrated. ... This tool will scan and diagnose, then repairs, your PC with patent pending technology that fix your windows operating system registry structure. Using Bwa And Samtools Together I am trying to perform the alignment using bwasw and then using samtools to report the aligned se...

I'm trying to align the denovo assembly scaffolds I have generated to the available refer... Can't convert SAM to BAM. I'm now going to include the commands I had used earlier which created the error: Here is a bit of one of my input fastq files: gunzip -c Sample_1.fastq.gz | head Powered by Biostar version 2.3.0 Traffic: 1085 users visited in the last hour To use Google Groups Discussions, please enable JavaScript in your browser settings, and then refresh this page. .

Samtools Parse Error At Line 1

How to extract unique mapped results from Bowtie2 bam results? In the past I've seen non-printing control characters getincorporated into the base call quality string (never from bwa). [w::sam_read1] Parse Error At Line [main_samview] Truncated File. This is technically invalid in the current > SAM specification (though there is no real reason for disallowing it, and I > would mildly advocate for relaxing that), and samtools rejects Missing Sam Header How exactly did you generate it?

SRA Toolkit and bowtie2: 0.00% overall alignment rate - what am I missing? this content Next, Iconverted these 500 SAMs to BAMs using the following command:*samtools view -bS file.sam > file.bam*using samtools version 0.1.18 (r982:295).I could convert 443 out of the SAMs into BAMs without any Compatibility: Windows 7, 8, Vista, XP Download Size: 6MB Requirements: 300 MHz Processor, 256 MB Ram, 22 MB HDD Limitations: This download is a free evaluation version. All Rights Reserved. Samtools View

Find More Posts by maubp 11-25-2013, 02:50 PM #12 anaqib2 Junior Member Location: Chicago Join Date: Nov 2013 Posts: 3 Hi Hi maubp i found the issue. Mapping to the transcriptome using Bowtie - am I doing it right? Just guessing.- tom blackwell -"sequence and quality are inconsistent" probably is triggered by a recordwhere the string of base call quality values has a different number ofcharacters from the string of http://newmicros.net/parse-error/parse-error-php-last-line.html How to easily fix Parse Error At Line 1 Not Well-formed (invalid Token) error?

I am trying to reproduce some results from a paper, in which smallRNA sequencing reads are mapped... For the first time I am using bwa mem using the command: /seqprg/bwa-0.7.5a/bwa mem -t 10 -C -M human_g1k_v37.fasta Sample.fastq > SampleA.sam I am getting the following error: [samopen] SAM header If you are not the intended recipient (or have received this e-mail in error) please notify the sender immediately and destroy this e-mail.

bowtie -v 2 -k 10 --best -S -f file.fasta file.sam This was the case for quite a few reads.

This is common error code format used by windows and other windows compatible software and driver vendors. Igv Not Recognizing Samtools Sorted And Indexed Files. Please don't fill out this field. error in samfile header I am getting an error in Picard using a modified bed file that was generated using.  I apologize ...

ADD REPLY • link written 4.7 years ago by Andreas • 2.3k I agree the output looks odd, there are no sequence names f.e. This information is intended only for the use of the individual(s) and entity(ies) to whom it is addressed. Cheers. http://newmicros.net/parse-error/parse-error-at-line-173.html If you are the intended recipient, further disclosures are prohibited without proper authorization.

Firstly I aligned the reads usin... Hope some-body can help me Marike visserm View Public Profile Send a private message to visserm Find More Posts by visserm 11-25-2013, 10:26 AM #10 anaqib2 Junior Member Any unauthorized copying, disclosure or distribution of the material in this e-mail is strictly forbidden and possibly a violation of federal or state law and regulations. about • faq • rss Community Log In Sign Up Add New Post Question: Samtools To Analyze Bwa Output 0 4.7 years ago by Dawnoflife • 10 Dawnoflife • 10 wrote:

ADD COMMENT • link written 4.7 years ago by Michael Dondrup ♦ 39k Will you delete my post as it has been wrongly accepted as the answer? I know bwasw gives the ou... ADD REPLY • link written 3.4 years ago by John Marshall • 870 Please log in to add an answer. If you're setting this via bwa, it > would be interesting to see the relevant bwa command line (and what version > of bwa you're using). > > John > >

This makesit hard to see on the screen exactly how many characters there are.- tom blackwell -Post by Thorhildur JuliusdottirDear all,I generated 500 .SAM files with BWA (version0.6.1-r104). In the past I'veseen non-printing control characters get incorporated into the basecall quality string (never from bwa). Windows 8 language shortcut, change language Download without installing downloader Be aware of a new type of facebook spam from lopsi... [已解决]windows 8 蓝屏问题 Disable Bing search page when you open Error Calling Samtools View On Bwa Sam Output Hi, I've aligned some data using BWA, and am now trying to convert from sam to bam and am gett...

Parse error at line 85: missing colon in auxiliary data Aborted (core dumped) Here is that line (85): HWI-ST1097:95:D0U82ACXX:7:1101:1400:2239 16 X 38482098 60 101M * 0 0 CTCTGCAAAATGATATGCAAGTATTAGTTGTGTGTATATTTCTGTTTGTTTGGGATAGCCTTGCCTACTGAAGAGCATAAGAAGCTGGGTTTCTCCTCATT ######################################@=39ABC;>B;D8?0?09*?109D:11*11::1*:22+AC?C<3+3?A:+CD?>BD>DAD

Please refer to our Privacy Policy or Contact Us for more details You seem to have CSS turned off. ADD REPLY • link written 4.7 years ago by Michael Dondrup ♦ 39k Added the code i used for bwa and my query file! Parse error at line 95: missing colon in auxiliary data Aborted head -96 file.sam | tail -5 @SQ SN:chrUn_gl000226 LN:15008 @SQ SN:chr18_gl000207_random LN:4262 @RG ID: LB: SM: PL:ILLUMINA D3B4KKQ1:406:H0YE0ADXX:2:1101:1198:2135 89 chr8 Screenshot instructions: Windows Mac Red Hat Linux Ubuntu Click URL instructions: Right-click on ad, choose "Copy Link", then paste here → (This may not be possible with some types of

Powered by Blogger. Bwa - Bwasw Option - What'S The Output? Start your 15-day FREE TRIAL of AppDynamics Pro!