Home > Parse Error > Parse Error At Line 1 Invalid Cigar Character

Parse Error At Line 1 Invalid Cigar Character

I wouldn't expect this error to result from this cause, but if the technical run issues are cleared up, content issues will pop out next. Thanks Ramzi Last edited by ramouz87; 11-13-2009 at 05:20 AM. Click here to register now, and join the discussion Community Links Members List Search Forums Show Threads Show Posts Tag Search Advanced Search Go to Page... Register for BlackBerry® DevCon today! > > > > _______________________________________________ > > Samtools-help mailing list > > [email protected] > > > > > > > > Thread view [Samtools-help] his comment is here

Create a password I agree to the terms of service Signed in as (Sign out) Close Close Post comment Submitting... Please refer to our Privacy Policy or Contact Us for more details You seem to have CSS turned off. The common reason for these errors are virus. Please compare the input to the spec in: > > > - tom blackwell - > > On Wed, 14 Sep 2011, Peter Cock wrote: > > > On Wed,

For mapped reads, an extra blast-like output was added below the .sam format line: HWI-ST945_0069:2:1101:5660:19675#GNNGNN 0 ref1 1946 54 30H15M1I7M47H * 0 0 GGAAAGTGACACCAAGAAGTTCA ihiiihfghhhifghgfhhfhhh AS:i:18 QUERY: 31 GGAAAGTGACACCAAGAAGTTCA 53 - Note that fileout has no extension as it is automagically appended by samtools. Content Search Users Tags Badges Help About FAQ Access RSS Stats API Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

  1. It does not have the '@' headers.
  2. I used Tophat2 in my work.
  3. A certain procedure that your computer must undertake is what such problems indicate.
  4. Iinvalid CIGAR character'It seems I am not the only one with that problem.
  5. I am running HTseq-count on galaxy cloud on some BAM files generated from galaxy Tophat.
  6. Faulty BAM/SAM files after Bowtie2, filtering and sorting Hi, I have some ChIP-seq data which I have aligned with Bowtie2 on Galaxy which gave me BAM file...
  7. My sam file after headers looks like this - scaffold1 4 * 0 0 * * 0 0 55278387 0 - 100 #DOWN 68667525:5:56 68667525 127 + 556 #DOWN 63995574:5:107 60040051:2:45
  8. From the output format, I believe this is a TopHat output.
  9. Should I replace these with something?

below is the lines 25640-25650 HWI-ST365_0135:2:1101:17649:2719#TACTAG-1 16 gnl|Cflo_3.3|scaffold1656 205450 42 28M66N22M * 00 GGAAGCTACGGCTGCTAATATTATGAAGGCCATCGTTTTGATAACTGGCG `\c_Ybb_be\gggggggggggggggggggggggggfggggggggggggg AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:50 YT:Z:UU HWI-ST365_0135:2:1101:17674:2720#TACTAG-2 16 gnl|Cflo_3.3|scaffold469 269161 42 19M495N31M * 00 And the same problemcame up with the satble last version of samtools...Can you help me ?FrancoisPS: I used BWA 0.5.8a for my mapping- --- --------------------------------------------------------Francois Sabot, PhDBe realistic. I thought that cuffdiff... Feb 27, 2013 Shishir K Gupta · Universität Heidelberg Thanks for your reply..

I did not get any bug dat... I don't know if anyone has already encountered this problem ? which bwa and samtools version are you using? Any thoughts?

What is the actual problem here? 1 vote Vote Vote Vote Vote Sign in prestine Your name Your email address Check! Make certain that all inputs are based on the same reference genome. Similar posts • Search » error using HTseq-count for conversion of .bam to raw counts Hello, I am trying to convert the .bam files I got as output from tophat alignment Continue [Crac-bugs] [CRAC 1.3.0] samtools conversion Laurent MANCHON lmanchon at Mar 11 Juin 16:02:32 CEST 2013 Message précédent: [Crac-bugs] [CRAC 1.3.0] samtools conversion Message suivant: [Crac-bugs] [CRAC 1.3.0] samtools conversion

Similar Threads Thread Thread Starter Forum Replies Last Post sam2bam error Hit Bioinformatics 1 07-06-2011 01:50 AM Thread Tools 11-12-2009, 04:21 AM #1 m_elena_bioinfo Member Location: Ospedali Riuniti This Galaxy wiki has advice if you need to understand how to investigate: Reference Genomes and Mismatch Issues Hopefully this helps! Normal alignment CIGAR value and TopHat alignment CIGAR value are bit different. I've made BAM file using TopHat2 and RefSeq mm10 gtf file for Junctions.

It means half of the base aligned in one position and the remaining half aligned after an intron. Thanx! BAM file not working with Cufflinks or IGV Hello Galaxy Team, I am a complete novice at this, and have been unable to find the answer to my... Parse error at line 1: invalid CIGAR character Aborted If I run: >samtools import reference.fasta aln.sam prova.bam the error [sam_header_read2] 1102 sequences loaded.

All computer users will come across Parse Error At Line 1 Invalid Cigar Character, it normally happens. Register for BlackBerry® DevCon today! > > > > _______________________________________________ > > Samtools-help mailing list > > [email protected] > > > > > > > > SourceForge About Site Segmentation fault I'm using samtools 1.7 and maq 0.7.1 Anyone faced such case ? weblink Second: it seems that the result of CRAC is not reproducible and depend on the number of threads used, i found a difference in size of the output file: 526909440 Jun

Error Bam File Is Malformed: Premature End Of File Using Gatk Tool Baserecalibrator Dear all, i am trying to use BaseRecalibrator tool fron GATK and become this error: ERROR MESSAG... It does not have the '@' headers. > >> > >> I'm trying to generate .bam with samtools view, but getting the following > >> error: > >> > >> ############################## All that you should do to make the process work is to go over the advance system Error In Sam To Bam Conversion - BioStar setting via control panel.

Parse error at line 1: invalid CIGAR character It may be that my previous successful runs were with BAM files with which I used an Ensembl gtf file, so the nomenclature

You seem to have CSS turned off. IGV can't view SAM file I'm trying to view SAM files I have got after alignment using IGV.  When I try to load the SAM fi... reference.fa has a separate reference.fa.fai file. But if there's no issue with your RAM, all you have to do is to add some additional space in your page file.

It does not have the '@' headers. > >> > >> I'm trying to generate .bam with samtools view, but getting the following > >> error: > >> > >> ############################## When you know the cause, you will find the solution. what is the CIGAR string? about • faq • rss Community Log In Sign Up Add New Post Question: HTSeq-Count Error on Cloudman 0 19 months ago by madkisson • 30 United States madkisson • 30

invalid email (thinking…) Reset or sign in with UserVoice password Forgot password? I am using command $ samtools view -b -S -o bowtie.glob.bam bowtie.glob.sam, but I am getting the following error: Parse error at line 25645: invalid CIGAR character Could someone please help