newmicros.net

Home > Parse Error > Parse Error At Line 1 Cigar And Sequence Length Are Inconsistent

Parse Error At Line 1 Cigar And Sequence Length Are Inconsistent

Just for kicks, i tried switching out "I" for "D", and I got the same error. Sign in to comment Contact GitHub API Training Shop Blog About © 2016 GitHub, Inc. Can you tell me if I > am thinking about this incorrectly? I run : library(ShortRead) reads <- readFastq("myFile") treads <- trimEnds(reads, a = "5") #trim at a quality score of 20 nreads <- treads[width(reads) > 21] # keep only reads longer than his comment is here

Jumpstart your > developing skills, take BlackBerry mobile applications to market and stay > ahead of the curve. I've got a FASTQ file... Probably they start with 1 rather than zero; maybethey include the header block, maybe not. This error of inconsistent read and CIGAR lengths comes from samtools view -Sb receiving bwa mem output, and has turned up in most mappings of individual lanes.

Briefly describe the problem (required): Upload screenshot of ad (required): Select a file, or drag & drop file here. ✔ ✘ Please provide the ad click URL, if possible: Home Browse example: >seq1 GATATTGGCGCGGCTCAATCA -- >seq2 GATATTGGCGCGGCT >seq3 GATATTGGCGCGGC And it was exist several times in different lines. Then I copied the mapped sequence and search it on my readfile.fa I noticed that the following line had "--" instead of seq data. ADD COMMENT • link written 3.5 years ago by xiaoyanli82 • 0 Please log in to add an answer.

  1. Click here to register now, and join the discussion Community Links Members List Search Forums Show Threads Show Posts Tag Search Advanced Search Go to Page...
  2. Does htseq-count recognize soft clipping generated by STAR?
  3. Re: [Bio-bwa-help] inconsistent read and CIGAR lengths in 0.7.3a?
  4. Scofield wrote: > Hi, I've been mapping some 100-200 bp single-end reads composed of joined overlapping PE reads.
  5. No, thanks Skip to content Ignore Learn more Please note that GitHub no longer supports old versions of Firefox.
  6. These are the reads that caused the error in the first post (with yara 0.9.0).
  7. I am confused with the tags in sam files generated by stampy.
  8. [email protected]
  9. Error with MuTect: SAM/BAM file SAMFileReader is malformed I tried to run MuTect with following command line; /usr/lib/jvm/java-1.6.0/bin/java -Xmx2g -jar ...
  10. I us...

More specifically, I am trying to convert a sam file generated using 'miraconvert' from a MIRA *.caf file. Please refer to our Privacy Policy or Contact Us for more details You seem to have CSS turned off. Join us from November 9-12, 2009. anybody know of a quick way of reading/interpreting the sum of a CIGAR field in order to remove the offending lines?

If you add up the numbers in the cigar line, it ads up to 240. This issue has been raised in [mira_talk]: http://www.freelists.org/post/mira_t...sam-conversion Note that the above code: "cat yoursample.sam | awk '{if (length($10)!=length($11)) print p+1" "$0;p++}'" will not necessarily work for this issue, since in You seem to have CSS turned off. cat yoursample.sam | awk '{if (p!=18632881) print $0;p++}'" > fixed.sam # note the zerobased couting using 18632881, not 18632882 Nobody's going to miss one read.

Member esiragusa commented Nov 13, 2014 @kaktus42 I close this issue as I am not able to reproduce it without your input. They're supposed to be for paired end, ... tophat2 --... Terms Privacy Security Status Help You can't perform that action at this time.

Thanks! Scofield - 2013-03-18 15:51:18 Attachments: Message as HTML Hi, I've been mapping some 100-200 bp single-end reads composed of joined overlapping PE reads. I come up to aligning the fastq file based on the reference and as a result, I got the aligned ba... Three of the libraries had no `accepted_hit.bam` file, while they did have a junctions.bed, and had an error of "Error: could not convert to BAM with samtools".

I want to remove all the reads that have hard... http://newmicros.net/parse-error/parse-error-php-last-line.html Cuffquant Error:- BAM error: CIGAR op has zero length Hi everyone,  I am trying to run cuffquant using the mm10 genome. Gviz Sashimi Plots I am trying to do some sashimi plots using directly a bam file obtained from TopHat, I but keep g... Password Register FAQ Community Calendar Today's Posts Search You are currently viewing the SEQanswers forums as a guest, which limits your access.

But it is not the best solution when the error continues within different lines. findOverlaps on GAlignments object   Consider this example: require(GenomicRanges) require(GenomicAlignments) b.gr = GRanges(Rle... In the past I'veseen non-printing control characters get incorporated into the basecall quality string (never from bwa). http://newmicros.net/parse-error/parse-error-at-line-1-invalid-cigar-character.html Reload to refresh your session.

But i... Can you tell me if I > am thinking about this incorrectly? I would experiment with a few lines around the one namedin the error message, looking for an instance where the number of charactersdiffers.

How to improve the pipeline of call snp in RNA-seq?

From: Heng Li - 2013-03-18 17:02:17 Attachments: Message as HTML Hmm.. Many (9 of 12) libraries worked with out error. Blackwell 2013-02-05 12:52:17 UTC PermalinkRaw Message In fact, it occurs to me to ask whether the unix "locale" under whichsamtools and bwa were compiled contains any multi-byte characters inthe collating sequence. Scofield > Umeå Plant Sciences Centre > Umeå University, Umeå Sweden > [email protected] > [email protected] > > > ------------------------------------------------------------------------------ > Everyone hates slow websites.

SEQanswers > Bioinformatics > Bioinformatics CIGAR and Sequence length incosistent User Name Remember Me? Scofield > Umeå Plant Sciences Centre > Umeå University, Umeå Sweden > [email protected] > [email protected] > > > ------------------------------------------------------------------------------ > Everyone hates slow websites. Sign in to comment Contact GitHub API Training Shop Blog About © 2016 GitHub, Inc. http://newmicros.net/parse-error/parse-error-at-line-173.html Or if this is a bug?

Can you tell me if I am thinking about this incorrectly? Extract Data From Dssp Output I have some dssp files in a folder f1. Or if this is a bug? > > Thanks! > > Nicole > > ------------------------------------------------------------------------------ > Come build with us! ADD COMMENT • link written 3.6 years ago by Michael Dondrup ♦ 39k 0 3.5 years ago by xiaoyanli82 • 0 xiaoyanli82 • 0 wrote: I tried my data using the

We recommend upgrading to the latest Safari, Google Chrome, or Firefox. I want to extract the lines from these files only if the v...